Jean-Philippe THERRIEN, Vickram BISSONAUTH, and Regen DROUIN*

Dept of Medical Biology, Faculty of Medicine, Université Laval, and
Unité de Recherche en Génétique Humaine et Moléculaire,
Research Center, CHUQ, Pavillon Saint-Francois d'Assise, 10 de l'Espinay St
Quebec (Quebec) Canada G1L 3L5

*corresponding author:
Unité de Recherche en Génétique Humaine et Moléculaire, Centre de Recherche, Pavillon Saint-François d'Assise, CHUQ 10 rue de l'Espinay, Quebec (Quebec) G1L 3L5, Canada
Tel.: (418) 525-4402, Fax: (418) 525-4481, email: regen.drouin@crsfa.ulaval.ca

Our purpose was to adapt the non-isotopic digoxigenin-based probe labeling method and chemiluminescent detection system (Roche Applied Science) to reveal DNA sequence ladders after LMPCR amplification, genomic sequencing gel and electroblotting. The probe to be hybridized on large nylon membranes was labeled with digoxigenin and detected with chemiluminescence. The non-isotopic method was compared to the conventional isotopic method. Due to its higher specificity, higher sensitivity, lower background and lower cost, the digoxigenin-based probe labeling and chemiluminescence detection method is highly recommendable.

The ligation-mediated polymerase chain reaction (LMPCR) is the most sensitive genomic sequencing technique available for mapping rare single-strand breaks at the nucleotide level of resolution. To date, LMPCR has been used to map in vivo protein-DNA interactions, to sequence uncloned genomic DNA, to analyze DNA methylation, to verify the presence of particular chromatin structure in living cells and to study DNA damage distribution (1, 2, 3, 4, 5, 6, 7, 8). The distribution of cyclobutane pyrimidine dimers (CPDs) at the sequence level, the typical DNA damage produced by UVB (280-320 nm) and UVC (200-280 nm), has been studied along several human gene sequences using the LMPCR technology (9). In particular, this technology can be used to study the promoter region of different genes after UV exposure. It has been reported that the frequency of DNA damage generated by UV can be modulated by protein-DNA interactions (6, 10), a phenomenon termed photofootprint. A positive photofootprint is seen when the UV-induced damage frequency of cellular DNA is higher than that of naked DNA. On the other hand, a negative photofootprint is observed when UV-induced damage frequency of cellular DNA is lower than that of naked DNA. When applied to living cells, dimethylsulphate (DMS) diffuses to nuclear DNA where it preferentially methylates guanine residues through the major groove at the N7-position. Guanine residues in contact with sequence-specific DNA-binding proteins display a different degree of reactivity with DMS compared with guanine residues not in contact with binding proteins. Proteins in contact with DNA either decrease accessibility of specific guanines to DMS (protection or negative footprints) or, often at the edges of a footprint, increase reactivity (hyperreactivity or positive footprints) (2). Hyperreactivity and protection can also indicate a modified DMS accessibility caused by special in vivo DNA structures.

There are two different approaches to visualize sequence ladder fragments amplified by LMPCR: i) by using a third primer, which is radiolabeled, for 1 to 2 extra PCR cycles (11) and, ii) by electroblotting the DNA fragments onto a nylon membrane followed by hybridization with a single-stranded radiolabeled probe (1). These two different methods thus involve radioactive labeling for detection of LMPCR-amplified sequence ladder fragments. Manipulation, storage and disposal of isotopes are expensive and can be hazardous, hence the need to use non-isotopic detection methods. The objective of this project was to adapt a non-isotopic digoxigenin-based method using chemiluminescence to detect sequence ladder fragments on large nylon membranes. The specificity (background) and sensitivity (exposure time) of the conventional isotopic approach have been compared to that of the non-isotopic method. The nonisotopic method has a lower exposure time, and yields sharper sequence ladders as well as lower background comparatively to the isotopic method. In this investigation we studied in vivo protein-DNA interactions following dimethylsulphate (DMS) treatment and UV exposure along the c-jun promoter using the LMPCR technology (Figure 1).

Materials and Methods

The various steps of the LMPCR technique are outlined in Figure 1. The modification step (Step 1 in Figure 1): DNA damage was induced using UV irradiation or dimethylsulphate (DMS) treatment. Human fibroblasts (in vivo system) and purified DNA (in vitro system) were irradiated with UV light or treated with DMS (8, 12). Confluent monolayer fibroblasts were then exposed to either 10 000 J/m² of UVB or 200 J/m² of UVC on ice. Purified DNA dissolved in a physiological buffer (150 mM KCl, 10 mM NaCl, 1 mM EDTA, 10 mM Tris-HCl pH 7.4) at a concentration of 65 µg/ml was then irradiated on ice with the same doses of UVB and UVC (8). Alternatively, fibroblasts were treated with 0.2% DMS at room temperature for 6 minutes and purified DNA (50 Rg) was treated with DMS as previously described (12). Nuclei isolation and DNA purification were performed as usual (13).

The conversion step (Step 2 in Fig. 1): the modified bases were converted into single-strand breaks with a 5'-phosphate group either enzymatically or chemically.

Cleavage at CPD:

Briefly, DNA aliquots (10 µg) were digested in 50 mM Tris-HCl, pH 7.6, 1 mM EDTA, 50 mM NaCl, 1 mM dithiothreitol, and 100 µg/µl bovine serum albumin at 37°C for one hour with T4 endonuclease V (kindly provided by R. Stephen Lloyd) in a total volume of 100 µl (6, 9). After T₄ endonuclease V cleavage, the 5'-overhung base was removed by UVA-driven photolyase (kindly provided by Aziz Sancar) photoreactivation. Then, the reaction was stopped with sodium dodecyl sulphate (SDS; final concentration 0.5%), DNA was extracted by phenol-chloroform method and precipitated for 20 min on dry ice with 18 µl of 5 M sodium chloride, and 2.5 volumes of ethanol 100%. Finally, the air-dried DNA pellets were resuspended in Sequenase buffer (40 mM Tris-HCl pH 7.7 and 50 mM NaCl) at a final concentration of 0.16 µg/µl (13).

The DMS treated DNA (50 µg) was incubated at 90°C with 1M piperidine for 30 min (5) (Pfeifer et al. 1991). The in vivo and in vitro DNA were resuspended in Sequenase buffer at a concentration of 0.16 µg/µl.

Primer-extension step (Step 3 in Figure 1): a gene-specific primer (Primer 1) was annealed at 48°C and the primer was extended with Sequenase enzyme at 48°C. Ligation step (Step 4 in Figure 1): all extended DNA fragments with a blunt-end and 5'-phosphate group were ligated to an unphosphorylated synthetic asymmetric double-strand linker. Linear amplification step (Step 5 in Figure 1): a second gene-specific primer (Primer 2) was annealed to DNA fragments for a one-cycle extension using Taq DNA polymerase (Roche Applied Science). Exponential amplification step (Step 6 in Figure 1): the primer 2 and the linker primer (the longest of the two oligonucleotides of the linker) were used to exponentially and specifically amplify DNA fragments. Sequencing gel electrophoresis and electroblotting (Step 7 in Figure 1): amplified DNA fragments were size-separated on a denaturing 8% polyacrylamide gel and transferred onto a nylon membrane (Roche Applied Science, positively charged Nylon membranes, lot: 83074401, 1092A) by electroblotting. Hybridization (Step 8 in Figure 1): the nylon membrane was hybridized overnight with a gene-specific probe. The LMPCR protocol used in this investigation has already been published in detail (13).

Primer set JD of c-jun promoter was used (14); primer JD-1 (CCGCGCACCTCCACTC, Tm: 53°C) was used for the primer extension, primer JD-2 (ACCTCCACTCCCGCCTCGCTGC, Tm: 67°C) for the amplification step, and primer JD-3 (CCTCGCTGCTTCAGCCACACTCA, Tm: 63°C) used for the preparation of non-isotopic and isotopic probes.

To prepare the isotopic probe, PCR products from c-jun promoter were used as the template. To radiolabel the probe, (a -³²P)dCTP (3000 Ci/mmole) nucleotide was incorporated during the linear PCR amplification. The following mix was prepared in a final volume of 150 µl: 0.01% gelatin, 10 mM Tris-HCl pH 8.9, 2 mM MgCl₂, 40 mM KCl, 0.25 mM of dATP, dGTP, and dTTP, 5 to 20 ng of PCR products, 75 pmoles of primer 3, 5 Units of Taq DNA polymerase (Roche Applied Science), and 10 µl of [³²P]dCTP. The mix was cycled once at 97°C (3 min), 62°C (2 min), and 74°C (3 min), followed by 29 cycles at 95°C (1 min), 61°C (2 min), and 74°C (3 min). The probe was precipitated at room temperature with 50 µl of NH₄Ac 7.5 M, 1 µ1 of glycogen (20 mg/ml), and two volumes of cold ethanol 100%. The pellet was dissolved in 100 µl of 10 mM Tris-HCl pH 8 and 1 mM EDTA (TE) and mixed with 7.5 ml of hybridization buffer (0.25 M Na₂HPO₄, 1 mM EDTA, 1.0% BSA, 7% SDS).

To prepare the non-isotopic probe, PCR products from c. jun promoter were used as the template. To label the probe with digoxigenin, DIG-dUTP nucleotide (Roche Applied Science) was incorporated during a linear PCR amplification. The same mix was prepared as for the radiolabeled probe, except for the radioactive nucleotide which was replaced by 1.2 µl of 0.5 mM digoxigenin-11-dUTP (Roche Applied Science) and the dNTP mix (25 mM dATP, 25 mM dGTP, 25 mM dCTP, and 20 mM dTTP; Roche Applied Science), which was diluted 1/8.3. The same amplification cycles were used as with the radiolabeled probe. After the usual probe precipitation, the pellet was dissolved in 100 µl of TE and mixed with 15 ml of pre-hybridization buffer: 5X SSC (1X SSC: 0.15 M NaCl and 0.015 M Na-citrate, pH 7), 1.0% of casein, 0.1% N-lauroylsarcosine, and 0.02% SDS. The nylon membrane (Roche Applied Science) was prehybridized for at least 3 h with 20 ml of prehybridization buffer at 67°C and hybridized overnight with 7.5 ml of hybridization buffer (pre-hybridization buffer + nonisotopic probe) at 67°C. The membrane was washed twice with 20 ml of 2X washing solution (2X SSC and 0.1% SDS) for 5 min at room temperature, followed by two washes with 20 ml of 0.1X washing solution (0.1X SSC and 0.1% SDS) for 15 min at 65°C. The membrane was manipulated exclusively with tweezers and was not allowed to dry following the hybridization step.

The membrane was washed with 50 ml of Buffer 1 (100 mM Maleic acid, 150 mM NaCl, pH: 7.5) for one min at room temperature. It was then transferred to a new recipient and incubated with 20 ml of Buffer 2 [Buffer 1 + 1% (w/v) casein] for 1 h at room temperature. The anti-digoxigenin antibody (Roche Applied Science) was diluted 1 :10,000 in 20 ml of Buffer 2, 5 min before the end of the incubation with Buffer 2. Following the one-hour incubation, Buffer 2 was replaced by the diluted antibody solution and the membrane was left for 30 min at room temperature. Next, the antibody solution was removed and the membrane washed with 20 ml of Buffer 1. The membrane was transferred to a new recipient and incubated with 20 ml of Buffer 1 containing 0.3% Tween 20, for 15 min at room temperature. Buffer 1 was then replaced by 20 ml of Buffer 3 (100 mM Tris-HCl, pH: 9.5, 100 mM NaCl, 50 mM MgCl2) and incubated for 5 min at room temperature. The membrane was placed between two cellulose acetate sheets, and 0.5 ml/100 cm2 of CSPD diluted 1:100 in Buffer 3 was added to the membrane, between the acetate sheet sandwich. After careful removal of the air bubbles, the acetate sheets were heat-sealed and the membrane was incubated for 15 min at 37°C. Finally, the membrane was exposed on Kodak XAR-5 X-ray film for 40 min.

The in vivo protein-DNA interactions in the promoter region of the protooncogene c-jun have been studied previously by three different footprinting methods involving LMPCR (14, 15, 16). In vivo DNase I treatment following lysolecithin-permeabilization, DMS treatment, and UV exposure were the three methods used. Seven core recognition sequences for transcription factors have thus been localized. In this investigation six of these were analyzed using in vivo DMS footprinting and photofootprinting methods. These sequences were: a Related to Serum Response Factor (RSRF) (nucleotide [nt] -60 to -49), an AP-1-like sequence (nt -71 to -64), a CCAAT box element (nt -91 to -87), two SP-1 sequences (nt -115 to -110 and nt -123 to -118), and a Nuclear Factor jun (NF-jun) site (nt -140 to -132) (14, 15, 16). The region shown in Figure 2, analyzed using the primer set JD, reveals the upper (nontranscribed) strand sequence from nucleotide -42 to -140, relative to the major transcription initiation site. As expected, all six putative consensus sequences for transcription factors showed DMS footprints and/or photofootprints in primary human fibroblasts (Figures 2 and 3). In the case of RSRF, for example, five dipyrimidine sites were analyzed and four showed negative photofootprints, indicating a lower CPD frequency in fibroblasts as compared to purified DNA (Figures 2 and 3). Furthermore, DMS footprints located outside the putative consensus sequences were found (Figures 2 and 3). Thus, the presence of DMS footprints and photofootprints in these six consensus sequences confirm the binding of corresponding transcription factors (RSRF, AP-1, CCAAT box binding protein, SP1 and NFjun) in living fibroblasts.

The same DMS footprints and photofootprints had already been obtained for fibroblasts by Pfeifer et al. (14, 15, 16). We used this model to compare a nonisotopic probe labeling method with the conventional isotopic procedure for revealing genomic sequence ladders. In Figure 2A and 2C, the sequence ladders were revealed by a gene-specific isotopic ³²P-dCTP-labeled probe while in Figure 2B, the sequence ladder was revealed by a gene-specific non-isotopic digoxigenin-labeled probe. All three parts of Figure 2 clearly show the presence of footprints and photofootprints corresponding mostly to different sites of protein-DNA interactions on the c- jun promoter. However, as shown in Figure 2B, the sequence ladder revealed by non-isotopic labeling was clearer, sharper, and presented lesser background as compared to the isotopic labeling method (Figure 2A and 2C). Indeed, the bands obtained with the non-isotopic method could be distinguished more easily from each other as compared to those obtained with isotopic labeling. Furthermore, the general appearance of the non-isotopic sequence ladder showed similarities with the isotopic sequence ladder without intensifying screens (Figure 2B vs. 2C). All of the DMS footprints and photofootprints were revealed with the non-isotopic method as well as, if not better than, with the conventional isotopic method. Hence, the digoxigenin-based probe labeling method using chemiluminescence detection appears to show lower background and to be unquestionably more specific and more sensitive than the isotopic probe labeling method.

It is well known that the use of isotopes in Molecular Biology is associated with several disadvantages. Specifically, radioactive labeling entails rigorous precautions during manipulation, is costly, requires special set-ups for storage and disposal, and, above all, may cause serious health problems. Radiolabeled probes have to be used quickly due to their short half-life. Considering all these aspects, there is now a need to find non-isotopic methods for probe labeling purposes.

In this investigation we successfully adapted a digoxigenin-based non-isotopic labeling method to reveal DNA sequence ladders after DMS footprinting and photofootprinting of the promoter region of c-jun. This non-isotopic probe labeling method, detected using chemiluminescence, was compared to the conventional isotopic labeling procedure. We showed that the digoxigenin-based method was more sensitive, gave lesser background and sharper sequence ladder bands as compared to isotopic labeling.

On the other hand, unlike isotopic probes, digoxigenin-labeled probes are innocuous, readily disposable and can be stored for long periods and even reused. All these aspects further contribute to the lower cost of the non-isotopic method as compared to the usual isotopic method. It is worth noting, however, that this non-isotopic detection method requires a few minor precautions. First, the nylon membrane used for this type of detection must bear a specific amount of homogeneously distributed positive charge. For this purpose, Roche Applied Science provides a membrane on which the amount of positive charge is accurately controlled. Other types of membranes were tested, but all gave poor results compared to the Roche Applied Science membrane (data not shown). Secondly, the membrane should be handled with care.

The use of tweezers is strongly recommended in order to reduce the presence of non-specific spots and decrease the background. As seen in Figure 2B, despite every precaution, a few small spots appeared on the "chemiluminogram". These may originate from the powder from the gloves. An alternative explanation for these spots might be the presence of undissolved crystals in the antibody solution (to minimize this problem this solution can be spun for 1530 s before use) or in the detection buffer. Otherwise, the use of an appropriate membrane and meticulous handling can produce very good results with the non-isotopic detection method.

In conclusion, the results obtained with the non-isotopic digoxigenin-labeled probe for DNA sequence ladder detection are very promising. Due its higher specificity, higher sensitivity, lower background, and lower cost, the digoxigenin-based probe labeling and chemiluminescence detection method is highly recommendable.

The authors thank Nancy Dallaire for assistance with fibroblast culture, Aziz Sancar for photolyase, and R. Stephen Lloyd for T₄ endonuclease V. Supported by a grant from Roche Applied Science to R.D. and "La Fondation de l'Hôpital Saint-François d'Assise." "Le Centre de Recherche" is supported by "le Fonds de la Recherche en Santé du Quebec." R.D. holds a scholarship from the Cancer Research Society Inc./MRC and J.-P.T. a studentship from "Le Centre de Recherche."

1. Pfeifer, G.P., Steigerwald, S.D., Mueller, P.R., Wold, B., Riggs, A.D. (1989) Genomic sequencing and methylation analysis by ligation mediated PCR. Science 246:810-813.

2. Pfeifer, G.P., Tanguay, R.L., Steigerwald, S.D., Riggs, A.D. (1990) In vivo footprint and methylation analysis by PCR-aided genomic sequencing: comparison of active and inactive X chromosomal DNA at the CpG island and promoter of human PGK-1. Genes Dev. 4: 1277-1287.

3. Pfeifer, G.P., Steigerwald, S.D., Hansen, R.S., Gartler, S.M., Riggs, A.D. (1990) Polymerase chain reaction-aided genomic sequencing of an X chromosome-linked CpG island: methylation patterns suggest clonal inheritance, CpG site autonomy, and an explanation of activity state stability. Proc. Natl. Acad. Sci. USA 87:8252-8256.

4. Pfeifer, G.P., Riggs, A.D. (1991) Chromatin differences between active and inactive X chromosomes revealed by genomic footprinting of permeablized cells using DNase I and ligation-mediated PCR. Genes Dev. 5:1102-1113.

5. Pfeifer, G.P., Drouin, R., Riggs, A.D., Holmquist, G.P. (1991) In vivo mapping of a DNA adduct at nucleotide resolution: detection of pyrimidine (6-4) pyrimidone photoproducts by ligation-mediated polymerase chain reaction. Proc. Natl. Acad. Sci. USA 88:1374-1378.

6. Pfeifer, G.P., Drouin, R., Riggs, A.D., Holmquist, G.P. (1992) Binding of transcription factors creates hot spots for UV photoproducts in vivo. Mol. Cell. Biol. 12:1798-1804.

7. Pfeifer, G.P., Drouin, R., Holmquist, G.P. (1993) Detection of DNA adducts at the DNA sequence level by ligation-mediated PCR. Mutat. Res. 288:39-46.

8. Drouin, R., Therrien, J.-P. (1997) UVB-induced cyclobutane pyrimidine dimer frequency correlates with skin cancer mutational hotspots in P53. Photochem. Photobiol. 66:719-726.

9. Tornaletti, S., Pfeifer, G.P. (1996) Ligation-mediated PCR for analysis of UV damage. In Technologies for detection of DNA damage and mutations. (Edited by G. P. Pfeifer), pp. 199-209. Plenum Press, New York.

10. Becker, M.M., Wang, J.C. (1984) Use of light for footprinting DNA in vivo. Nature 309:682-687.

11. Mueller, P.R., Wold, B. (1989) In vivo footprinting of a muscle specific enhancer by ligation-mediated PCR. Science 246:780-786.

12. Drouin, R., Angers, M., Dallaire, N., Rose, T.M., Khandjian, E.W., Rousseau, F. (1997) Structural and functional characterization of the human FMR1 promoter reveals similarities with the hnRNP-A2 promoter region. Hum. Mol. Genet. 6:2051-2060.

13. Drouin, R., Rodriguez, H., Holmquist, G.P., Akman, S.A. (1996) Ligation-mediated PCR for analysis of oxidative DNA damage. In Technologies for detection of DNA damage and mutations. (Edited by G. P. Pfeifer), pp. 199209. Plenum Press, New York.

14. Rozek, D., Pfeifer, G.P. (1993) In vivo protein-DNA interactions at the c-jun promoter: preformed complexes mediate the UV response. Mol. Cell. Biol. 13: 5490-5499.

15. Rozek, D., Pfeifer, G.P. (1995) In vivo protein-DNA interactions at the c-jun promoter in quiescent and serum-stimulated fibroblasts. J. Cell. Biochem. 57:479-487.

16. Tornaletti, S., Pfeifer, G.P. (1995) UV light as a footprinting agent: modulation of UV-induced DNA damage by transcription factors bound at the promoters of three human genes. J. Mol. Biol. 249:714-728.

Figure 1. Schematic representation of the LMPCR procedure. Step 1, specific conversion of modified bases to strand breaks; Step 2, denaturation of genomic DNA; Step 3, annealing and extension of primer 1 with Sequenase; Step 4, ligation of the linker; Step 5, first cycle of PCR amplification, this cycle is a linear amplification because only the gene-specific primer 2 can anneal; Step 6, cycle 2 to 20 of exponential PCR amplification of gene-specific fragments with primer 2 and the linker primer (the longer oligonucleotide of the linker); Step 7, separation of the DNA fragments on a sequencing gel and transfer of the sequence ladder to a nylon membrane by electroblotting; Step 8, visualization of the sequence ladder by hybridization with a labeled single-stranded probe which abuts on primer 2.

Figure 2. Distribution of methylated guanines and CPD along the non-transcribed strand of the c-jun promoter following DMS treatment, and UVB and UVC irradiation respectively. Parts A and C: the membrane was hybridized with an isotopic ³²P-dCTP-labeled probe. The membrane was exposed on film with two intensifying screens for 25 min at -70°C (A). Next, the same membrane was exposed on film for 3 h at room temperature (C). Part B: the membrane was hybridized with a digoxigenin-labeled probe and exposed on film for 40 min at room temperature. For this experiment, one LMPCR protocol was carried out and only one gel was run on which all the samples (20 in total) were loaded symmetrically in duplicate. Each symmetrical well of each set of samples was loaded with exactly the same amount of DNA. Lanes 1-4, LMPCR of DNA treated with standard Maxim-Gilbert cleavage reactions. These lanes represent the sequence of c-jun promoter analyzed with JD primer set. Lanes 5-6, LMPCR of DMS treated naked DNA (T: in vitro) and fibroblasts (V: in vivo) followed by hot piperidine treatment. Lanes 7-10, LMPCR of UVC- and UVB-irradiated naked DNA (T) and fibroblasts (V) followed by T4 endonuclease V/photolyase digestion. On the right, the consensus sequences of transcription factor binding sites are delimited by brackets. The numbers indicate their positions relative to the major transcription initiation site.

Figure 3. Schematic map of DMS footprints and photofootprints along the analyzed sequence of the c jun promoter from nucleotide -42 to -140 relative to the major transcription initiation site. Open circles represent guanines which are protected against DMS-induced methylation (negative DMS footprints) in vivo. Closed circles represent guanines which are hyperreactive to DMS (positive DMS footprints) in vivo. Crosshatched squares indicate inhibition of UV-induced CPD formation (negative photofootprints) in vivo. The closed square indicates increased UV-induced CPD formation (positive photofootprints) in vivo. The brackets indicate dipyrimidine sites susceptible to the formation of CPD. The putative consensus sequences for transcription factor binding sites are enclosed in a box.